TEAM Trainees
2009-2010 Trainees
Post-Doctoral Fellow Program Trainees
Faculty Mentor: Cathy Krull
Home Department: Biologic and Materials Sciences, School of Dentistry
Research Project Title: Establishing EPH-expressing mouse embryonic stem cells for targeted integration in the nervous system.
Research Project Description: As therapeutic strategies for spinal cord injury and stroke are currently lacking, the experiments in this project are designed to preferentially target mESCs/hESCs to regions of the normal and lesioned CNS. Eph receptor tyrosine kinases (RTKs) and their membrane-associated ligands play multiple roles during development, including in axon patterning and cell migration. We are using the Sleeping Beauty (SB) transposon system to mediate stable integration and reliable long-term expression of Eph family members in mouse and human embryonic stem cells (ESCs). The specific aims of this project are 1) test whether EphA4 overexpression in mESCs alters neuronal differentiation and/or behavior; 2) determine whether EphA4+ ESCs preferentially integrate into ephrin-expressing territories in the developing chick spinal cord; and 3) engineer hESC lines to express Eph family members, for use as therapeutic strategies in rodent models of stroke.
Presentations:
Davidson, A. E., Gratsch, T. E., Colvin, A. M., O'Shea, K. S., and Krull, C. E. Targeting CNS integration of mESCs using Eph/ephrins.
Poster Presentation (2009) School of Dentistry Research Day. Ann Arbor, MI.
Davidson, A. E., Gratsch, T. E., O'Shea, K. S., and Krull, C. E.
Targeting CNS integration of mESCs using Eph/ephrins.
Poster Presentation (2008) 1st Annual Taubman Symposium. Ann Arbor, MI.
Davidson, A. E., Gratsch, T. E., O'Shea, K. S., and Krull, C. E.
Targeting CNS integration of mESCs using Eph/ephrins.
Poster Presentation (2008) International Society for Stem Cell Research 6th Annual Meeting. Philadelphia, PA.
Davidson, A. E., Gratsch, T. E., O'Shea, K. S., and Krull, C. E.
Targeting CNS integration of mESCs using Eph/ephrins.
Poster Presentation (2008) Southeast SDB Regional Meeting. Atlanta, GA.
Davidson, A. E., Gratsch, T. E., O'Shea, K. S., and Krull, C. E.
Establishing ES-derived neurons for targeted integration into the CNS using Eph/ephrins.
Poster Presentation (2007) 7th International Symposium on Organogenesis. Ann Arbor, MI.
Davidson, A. E., Addressing CNS integration of ES-derived neurons using Eph/ephrins.
Oral Presentation (2007) CDB Fall Retreat. W. K. Kellog Biological Station, Hickory Corners, MI.
Davidson, A. E., Gratsch, T.E., O'Shea, K. S., and Krull, C. E.
Establishing embryonic stem cells that express EphA4 using Sleeping Beauty.
Poster Presentation (2007) Midwest Developmental Biology Meeting, Chicago, IL.
Publications:
Davidson, A.E., Gratsch, T.E., Colvin, A.M., O’Shea, K.S., and Krull, C.E. (In Preparation). Establishment of Eph-expressing mouse embryonic stem cells for targeted integration into the CNS. (not yet submitted)
Davidson, A.E., Gratsch, T.E., Morell, M.H., K. Sue O’Shea, and Krull, C. E. (2009) A Novel Approach Using the Sleeping Beauty Transposon System for Stable Gene Expresion in Mouse Embryonic Stem Cells. Cold Spring Harbor Lab Protocols. (Accepted and in final revision)
Faculty Mentor: Brian Pierchala
Home Department: Biologic and Materials Sciences
Faculty Mentor: William Giannobile
Home Department: Periodontics and Oral Medicine
Research Project Title: Molecular and immunological mechanisms of susceptibility for rheumatoid arthritis in periodontal diseased patients
Research Project Description: Rheumatoid arthritis (RA) is an autoimmune disease that leads to inflammation and destruction of the joints. RA affects an estimated 1.3 million Americans. Clinical studies provide evidence of an association between patients with RA and periodontitis (PD), the most common oral infection afflicting humans. We hypothesize that PD may influence RA via several potential mechanisms, such as transient bacteremias and inflammatory cytokines released into the circulation due to the chronic infection of periodontal pathogens. The overall objective of this proposal is to explore potential immunological mechanisms by which PD may modulate RA.
Presentations:
2009 Oral infection and arthritic joint destruction – is there a relationship? Oral Health Sciences Seminar Series. Dental School, University of Michigan (ORAL)
2007 Marchesan JT, Pettway GJ, Berry JE, McCauley LK. PTH and PTHrP upregulate Megakaryocyte Stimulating Factor: a potential role in bone formation. Research Day, Dental School, University of Michigan (POSTER)
2005 The influence of periodontal disease in systemic diseases. Advisor: Sergio Luis Scombatti. Dental Association of Ribeirão Preto (AORP), Brazil (ORAL)
2005 Marchesan JT, Rodrigues TL, Novaes AB, Palioto DB. Analysis of the influence of a non-steroidal inflammatory medication in mucogingival surgeries. Internal Meeting of Research, Dental School of Ribeirão Preto, University of São Paulo, Brazil (POSTER)
2004 Effects of enamel matrix derivative and transforming growth factor-beta1 on human periodontal ligament fibroblasts. Brazilian Society of Dental Research (SBPqO – IADR’s Brazilian Division), Aguas de Lindoia, Sao Paulo, Brazil (ORAL)
Publications:
2009 Submitted
Marchesan JT, Scanlon CS, Soehren S, Matsuo M, Kapila YL. Determinants of periodontal ligament fibroblast behavior: a review - submitted
2007 J Clin Periodontol
Rodrigues TL, Marchesan JT, Coletta RD, Novaes AB Jr, Grisi MF, Souza SL, Taba M Jr, Palioto DB. Effects of enamel matrix derivative and transforming growth factor-beta 1 on human periodontal ligament fibroblasts. J Clin Periodontol. 2007;34:514-522.
2007 J Periodontol
Novaes Jr AB, Marchesan JT, Macedo G, Palioto DB. Effect of in vitro gingival fibroblast seeding on the in vivo incorporation of acellular dermal matrix allografts in dogs. J Periodontol. 2007;78:296-303.
2006 RGO
Hotta TH, Marchesan JT, Brugnera Jr A, Santos TM, Silva MAMR, Silva RS, Pecora JD.Use of laser and occlusal splint for dentin hypersensitivity of bruxers. RGO (Revista Odontologica Gaucha) 2006;54:195-198. [Portuguese]
2005 Braz Den J
Novaes Jr AB, Palioto DB, Andrade PF, Marchesan JT. Regeneration of Class II Furcation Defects: Determinants of Increased Success. Braz Den J.I 6:87-97,2005.
Faculty Mentor: Ormond MacDougald
Home Department: Molecular & Integrative Physiology
Research Project Title: MicroRNA and Wnt-mediated mechanisms of mesenchymal progenitor development
Research Project Description: The prevalence of clinical disorders associated with obesity underscores the necessity for understanding the mechanisms associated with adipogenesis and osteoblastogenesis, given the two processes reciprocal relationship. The aims of this project are to understand the molecular mechanisms of Wnt and microRNA function, two regulators of these processes, in developing mesenchymal progenitors.
Presentations:
- Sousa, K.M.,Prestwich, T., Gerin, I., Wright, W., and MacDougald, O.A. 2008 Regulation of preadipocyte recruitment and adipocyte growth by sFRP5. Keystone Conference on Molecular Control of Adipogenesis and Obesity, Banff, Canada.
- Clark, A.M.,Sousa, K.M.,MacDougald, O.A., and Kennedy, R.T. 2008. Detection of free fatty acids and glycerol secreted from adipocytes using fluorescence-based enzyme assays on a microfluidic platform. Pittsburgh Conference on Analytical Chemistry and Applied Spectroscopy (PittCon 2008). New Orleans, LA.
- Sousa, K.M.,Castelo-Branco, G., Hofstra, W., Brya, V., and Arenas, E. 2005. Purification of Wnt-2 and its effects on developing dopaminergic neurons. EurostemCell Summer School, Hydra, Greece.
- Arenas, E., Castelo-Branco, G., Parish, C.L.,Sousa, K.M.,Hall, A.C., Bryja, V., Schulte, G., Rawal, N., Sousa K.M., and Salto, C. 2005. Regulation of midbrain dopaminergic neurogenesis by Wnts. 15th International Society of Developmental Biologists Congress, Sydney, Australia.
- Sousa, K.M.,Mira, H., Hall A.C., Jansson-Sjöstrand, L., and Arenas, E. 2004. Gene expression profiles support a role for Nurr1 in promoting cell survival and neuronal differentiation of neural stem cells. 34th Annual Society for Neuroscience Conference, San Diego, California, USA.
- Sousa, K.M. 2004. Characterization of the transcriptional profile of a Nurr1-transfected neural stem cell line. European Commission program on the development of human dopaminergic neuronal cell lines for transplantation (DANCE), Munich, Germany.
- Shariatmadari, M., Peyronnet, J., Papachristou, P., Schulte, G., Sousa, K.M.,Arenas, E., and Ringstedt, T. 2004. Overexpression of Wnt7a in transgenic mouse neural stem cells increases VANGL2 expression and impairs neurulation by disturbing actin microfilament formation. European Society for Pediatric Research, Stockholm, Sweden.
- Rawal, N., Castelo-Branco, G., Sousa, K.M., and Arenas, E. 2003. Wnt signalling in the development of ventral mesencephalic dopaminergic neurons. Keystone Conference, Keystone, Colorado. USA.
- Sousa, K.M. Castelo-Branco, G., Wagner, J., Rodriguez, X., Kele, J., Rawal, N., and Arenas, E. 2003. The role of Wnts in the development of ventral midbrain dopaminergic neurons. International Society for Stem Cell Research, Washington, D.C, USA.
Publications:
- Wang, Y., Sousa, K.M., Bodin, K., Theofilopoulos, S., Sacchetti, P., Hornshaw, M., Woffendin, G., Karu, K., Sjovall, J., Arenas, E., and Griffiths, W.J., 2009. Targeted lipidomic analysis of oxysterols in the embryonic central nervous system. Mol. Biosyst. 5(5):529-41. PMID:19381367
- Clark, A.M., Sousa, K.M., Jennings, C., MacDougald, O.A., and Kennedy, R.T. 2009. Continuous-flow enzyme assay on a microfluidic chip for monitoring glycerol secretions from cultured adipocytes. Anal. Chem. 81(6):2350-6. PMID: 19231843
- Bennett, C.N., Ouyang, H., Ma, Y.L., Zeng, Q., Gerin, I., Sousa, K.M., Lane, T.F.,Krishnan, V., Hankenson, K.D., and MacDougald, O.A., 2007. Wnt10b increases postnatal bone formation by enhancing osteoblast differentiation. Journal of Bone and Mineral Research, 22(12):1924-32.
- Sousa, K.M.,Mira, H., Hall, A.H., Jansson-Sjöstrand, L., and Arenas, E 2007. Microarray analyses support a role for Nurr1 in promoting neuronal differentiation and resistance to oxidative stress. Stem Cells. 25(2):511-9.
- Shemer, I., Holmgren, C., Min, R., Fulöp, F., Zilberter, M.,Sousa, K.M., Farkas, T., Härtig, W., Penke, B., Burnashev, N., Tanila, H., Zilberter, Y., and Harkany, T. 2006. Non-fibrillar b-amyloid abates spike-timing-dependent synaptic potentiation at excitatory synapses in layer 2/3 of the neocortex by targeting postsynaptic AMPA receptors. Eur. J. Neurosci. 23: 2035-47.
- Rawal, N., Castelo-Branco, G., Sousa, K.M.,Kele, J., Kobayashi, K., Okano, H., and Arenas, E. 2006. Spatial and temporal expression dynamics of Wnt signaling components in the developing midbrain. Exp. Cel. Res. 312: 1626-36.
- Berghuis, P., Dobszay, M.B., Wang, X., Spano, S., Ledda, F., Sousa, K.M.,Schulte, G., Ernfors, P., Mackie, K., Paratcha, G., Hurd, Y., and Harkany T. 2006. Endocannabinoids regulate interneuron migration and morphogenesis by transactivating the TrkB receptor. Proc Natl Acad Sci USA. 22: 19115-20.
- Castelo-Branco, G., Sousa, K.M., Bryja, V., Pinto, L., Wagner, J., and Arenas, E. 2006. Ventral midbrain glia express region-specific transcription factors and regulate dopaminergic neurogenesis through Wnt-5a secretion. Mol. Cell. Neurosci. 31: 251-62.
- Shariatmadari, M., Peyronnet, J., Papachristou, P., Horn, Z., Sousa, K.M., Arenas, E., and Ringstedt, T. 2005. Elevated Wnt levels in the neural tube impairs the function of adherens junctions during neurulation. Mol. Cell. Neurosci. 30: 437-51.
- Schulte, G., Bryja, V., Rawal N., Castelo-Branco, G., Sousa, K.M., and Arenas E. 2005. Purified Wnt-5a increases differentiation of midbrain dopaminergic cells and dishevelled phosphorylation. J. Neurochem. 92: 1550-3.
- Berghuis, P., Dobszay, M.B.,Sousa, K.M., Schulte, G., Mager, P.P., Härtig, W., Görcs, T.J., Zilberter, Y., Ernfors, P., and Harkany, T. 2004. Brain-derived neurotrophic factor controls functional differentiation and microcircuit formation of selectively fast-spiking interneurons. Eur. J. Neurosci. 20: 1290-306.
- Harkany, T., Holmgren, C., Härtig W, Qureshi, T., Chaudhry F.A., Storm-Mathisen, J., Dobszay, M.B., Berghuis, P., Schulte, G.,Sousa, K.M., Fremeau Jr., R.T., Edwards, R.H., Mackie, K., Ernfors, P., and Zilberter Y. 2004. Endocannabinoid-independent retrograde signaling at inhibitory synapses in layer 2/3 of neocortex: involvement of vesicular glutamatetransporter 3. J Neurosci. 24: 4978-4988.
- Castelo-Branco, G., Wagner, J., Rodriguez, F.J., Kele, J.,Sousa, K., Rawal, N., Amalia Pasolli, H., Fuchs, E., Kitajewski, J., and Arenas, E. 2003. Differential regulation of midbrain dopaminergic neuron development by Wnt-1, Wnt-3a and Wnt-5a. Proc Natl Acad Sci USA. 22: 12747-12752.
- Akerud, P., Holm, P.C., Castelo-Branco, G., Sousa, K., Rodriguez, F.J., and Arenas , E. 2002. Persephin-overexpressing neural stem cells regulate the function of nigral dopaminergic neurons and prevent their degeneration in a model of Parkinson's disease. Mol. Cell. Neurosci. 21:205-222.
- Brown, C.E., Howe, L.H.,Sousa, K., Alley, S.C., Tan, S., and Workman, J.L. 2001. The ATM-related factor Tra1p is an essential direct target of transcription activators in the SAGA and Nua4 complexes. Science. 292: 2333-2337.
Faculty Mentor: Paul Krebsbach
Home Department: Biologic and Material Science Department
Research Project Title: Study of interconnection between substrates and human embryonic stem cells
Research Project Description: Cells interact with their microenvironment and respond to it. This project has the objective to research on cell membrane receptors that mediate the interconnection between natural and synthetic substrates and human embryonic stem cells. The understanding of substrate/cell connection may help us to control proliferation and differentiation, among other cell functions. Likewise, it will help us to elucidate molecular pathways involved in these biological functions.
Presentations:
Villa-Diaz, L.G., Krebsbach, P.H. Changes In Integrin Expression Of Human Embryonic Stem Cells (HESCs) During Early Differentiation. Stem Cell Niche Interactions; Keystone Symposia 2009. Whistler, British Columbia, Canada.
Villa-Diaz, L.G., Garcia-Perez, J.L., Krebsbach, P.H. Enhance Transfection Efficiency Of Human Embryonic Stem Cells By The Immobilization Of DNA Plasmid. 7th International Society for Stem Cell Research Annual Meeting 2009, Barcelona, Spain.
Villa-Diaz, L.G., Garcia-Perez, J.L., Krebsbach, P.H. Enhance Transfection Efficiency Of Human Embryonic Stem Cells By The Immobilization Of DNA Plasmid. Research Day 2009. University of Michigan, School of Dentistry, Ann Arbor, Michigan.
Villa-Diaz, L.G., Nogueira-de-Souza, N.C., Nandivada, H., Lahann, J., O’Shea, K.S., Smith, G.D., Krebsbach, P. Characterization Of Integrin Expression In Undifferentiated HESCs. 6th International Society for Stem Cell Research Annual Meeting 2008, Philadelphia.
Faculty Mentor: Laurie McCauley
Home Department: Orthodontics and Pediatric Dentistry
Research Project Title: The role of collagen and integrin in osteoclast signaling
Research Project Description:
Integrins are essential for osteoclastic bone resorption and hence are an integral part of skeletal development, regeneration and pathophysiology. The alphavbeta3 integrin is a major player whose activation contributes to cytoskeletal re-organization and cellular morphology change that facilitates sealing zone formation. M-CSF, a key inducer of osteoclastic differentiation stimulates alphavbeta3 activation in osteoclasts. However, the mechanism of inside-out signaling leading to alphavbeta3 integrin activation has not been clarified. Another integrin, the collagen receptor alpha2beta1, is also reportedly expressed in osteoclasts. In platelets, alpha2beta1 signaling to the alphaIIbbeta3 integrin, leads to platelet activation. Whether and how collagen and its receptor contribute to osteoclast function is not clear. Defining this mechanism will provide therapeutic insight into the modulation of bone resorption via control of integrin alpha2beta1 activity or signaling molecules that regulate inside-out signaling of alphavbeta3. In this study, I will examine the role of collagen and its receptor alpha2beta1 integrin in osteoclastogenesis and alphavbeta3integrin activation, and define how small GTPase contribute to integrin cross-talk.
Presentations:
The role of collagen in Osteoclastogenesis and Signaling. Gordon Research Conference (Bones and Teeth), 2009
Faculty Mentor: Renny Franceschi
Home Department: Periodontics and Oral Medicine
Research Project Title: A Novel Approach to Regeneration of Bone: Using High Intensity Focused Ultrasound to Trigger Heat Shock Protein-Driven Expression of Angiogenic and Osteogenic Factors
Research Project Description:
Reconstruction of bone defects remains a significant challenge in the clinical management of craniofacial injury and disease. Delivery of growth factors or gene expression vectors encoding such factors have demonstrated potential in promoting bone regeneration, but current methods typically lack stringent spatiotemporal control of growth factor bioactivity, which may be crucial for optimizing tissue integration with surrounding vasculature and bone. The goal of this project is to develop a technique for controlling gene expression in time and 3D space to promote early formation of vasculature and subsequent bone formation in engineered tissue constructs. The premise of the approach is that heat generated and spatially controlled by high intensity ultrasound (HIFU) can activate cells that are genetically modified to express basic fibroblast growth factor (bFGF) – a pro-angiogenic factor – under the dual control of a heat shock promoter and a rapamycin-activated transactivator. Additional cells modified to express bone morphogenetic protein 2 (BMP2) under control of the heat shock promoter and a mifepristone-activated transactivator will be triggered subsequent to vessel maturation to promote bone formation in the interstitium. By integrating gene therapy techniques with the emerging technology of HIFU, this approach may offer an innovative method of tightly regulating and enhancing bone regeneration in vitro and in vivo.
PhD Program
Faculty Mentor: Joerg Lahann
Home Department: Chemical Engineering
Research Project Title: Mammalian Cell Behavior on Complex Substrates
Research Project Description: Understanding interactions between mammalian cells and complex surfaces is crucial for the field of tissue engineering. Surfaces which promote cell adhesion and motility through selective immobilization of integrin-binding peptides and growth factors could be of great interest to the biomedical community. Chemical vapor deposition (CVD) has several advantages over other surface modification methods, primarily its ability to deposit polymer coatings conformally. In this work, CVD is used to coat thin polymer films onto silicon substrates. Integrin-binding peptide RGD and/or epidermal growth factor (EGF) are then immobilized after selective chemical modification. NIH3T3 fibroblasts and human umbilical vein endothelial cells are cultured on the surfaces and imaged using fluorescent microscopy. Geometric properties such as the total area of cell adhesion are quantified using image analysis software. Changes in cell signaling and wound healing ability depending on the presence/absence of EGF/RGD are also measured and quantified. Thus, this project will demonstrate a novel method of controlling cell behavior through multiple immobilized factors on CVD-modified surfaces.
Presentations:
Eyster T.W., Hartman I,. Wood, D., Novel biosensor for thyroid hormone endocrine disruptors, ACS 2008 National Meeting (poster presentation)
Illing A.C., Shawki A., Eyster T.W., and Bryan Mackenzie, Cysteinyl residues participate in regulation of SVCT1-mediated L-ascorbic acid transport, FASEB J. 2006 20:A840 (meeting abstract for poster from Experimental Biology Conference 2006)
J. Zhang, D. Davis, T. Eyster and E.J. Podlaha, “Electrodeposition of CoNiCu/Cu Multilayer Thin Films and Nanowires,” Gordon Conference, New London, NH, August 8-13, 2004.
Publications:
Masters Thesis: “A Novel Thyroid Hormone Receptor Biosensor” (PRIN 6848 2008.3331)
Faculty Mentor: Kate F. Barald
Home Department: Cellular & Molecular Biology Program
Research Project Title: The Role of the Cytokine MCP-1 in Zebrafish Inner Ear Neuronal Development and Regeneration
Research Project Description: Neuron loss is a significant contributing factor affecting loss of hearing, particularly in mammals, and is notable in the aging human population. At this time, there is no treatment for hearing loss based on neural regeneration in mammals, and the success of cochlear implants, the only form of treatment for many forms of hearing loss, is dependent upon the number of spiral ganglion neurons (SGN) remaining at the time of implantation. The early stage inner ear produces a quartet of cytokines, including monocyte chemoattractant protein 1 (Mcp-1), which is known to play a role as an important neurotrophic factor in the development and survival of bird and mammalian auditory system neurons (Bianchi et al., 2005). The hypothesis being tested is that this cytokine could enhance neuronal regeneration, and directional axonal re-growth in the adult and/or damaged inner. The development of the zebrafish auditory system recapitulates many aspects of mammalian inner ear development and neurogenesis, but it occurs at an accelerated rate and ex utero. Both sensory hair cells (HC) and neurons are capable of regenerating in the fish and bird auditory systems, in contrast to those of mammals. Therefore, we are investigating the role of Mcp-1 in neural tissue [statoacoustic ganglion (SAG)] regeneration in late larval zebrafish. We are also testing the role of mcp-1 in adult zebrafish SAG neuronal regeneration in vivo and in vitro. In the mouse, adult SGN express the receptor for MCP-1, CCR2, while production of MCP-1 appears to decline as the inner ear ages. We hypothesize that by restoring MCP-1 either alone or in combination with macrophage migration inhibitory factor (MIF), another cytokine found in otocyst-derived factor (ODF), an embryonic growth factor on which innervation of the ear depends, it will be possible to restore hearing function.
Presentations:
POSTERS:
8th International Meeting on Zebrafish Development & Genetics
28th Annual CMB Symposium, Ann Arbor, MI 09/2008
3rd Biennial Symposium of the Tissue Engineering and Regeneration Training Grant, Ann Arbor, MI, October 2008.
SHORT TALKS:
Midwest Developmental Biology Meeting, Chicago, IL April 2007.
ARO 32nd MidWinter Meeting, Baltimore, MD 02/2009
Title: The Cytokine Macrophage Migratory Inhibitory Factor (Mif) Plays Critical Roles in the Development of Zebrafish Inner Ear Sensory and Nerve Cells.
Faculty Mentor: Dr. David Kohn
Home Department: Biomedical Engineering
Research Project Title: Investigating the importance and control of collagen cross-linking in the formation, mechanical properties, and mechanical adaptation of bone
Research Project Description: Collagen cross-links are covalent ties which join collagen chains both inter- and intra-molecularly in connective and mineralized tissues. The profile (types and quantities) of cross-links is not collagen type specific but tissue specific, implying a role of cross-linking in functional adaptation; both bone and dentin display high fractions of immature cross-links compared to non-mineralizing collagen tissues. Alterations in bone collagen cross-linking profile are commonly observed in bone disease. Importantly, decreased bone collagen cross-linking is associated with a loss of tissue mechanical strength, and extracellular matrix lacking collagen cross-linking affects subsequent osteoblastic differentiation at the early stages. The effect of reduced cross-linking on late stages of differentiation and mineralization, as well as a thorough characterization of both the collagen and mineral phases, have not been reported. Though evidence exists that physical exercise affects the number of cross-links formed in young bone, the control of cross-linking during bone formation, their possible role in bone's adaptation to mechanical loading, and the effects of loading on cross-link formation are not well understood. This study aims to answer these questions using both in vitro and in vivo approaches, thus determining the importance and control of collagen cross-linking in the formation, mechanical properties, and mechanical adaptation of bone.
Presentations:
- Gatenby E.M., EC Lee, DH Kohn. Effect Of In-Vivo Mechanical Loading On Bone Marrow Stromal Cell Function In-Vitro Biomedical Engineering Society Annual Fall Meeting. Baltimore, MD. September, 2005.
Faculty Mentor: Shuichi Takayama
Home Department: Biomedical Engineering
Research Project Title: Directed Stem Cell Differentiation by Controlled Microenvironmental Cues Research
Project Description: There are many factors which dictate cell fate during stem cell differentiation. Microfluidics provides a platform in which these factors can be better controlled enabling their specific effects to be elucidated. The goal of this project will be to direct the differentiation of a population of embryonic stem cells by controlling the exogenous morphogen signals exposed to that population. We aim to control both the spatial and temporal exposure of these morphogens in order to yield sub-populations of different cell types. The hope is that with a better understanding of what the optimal cues are for stem cell differentiation, both higher efficiencies can be achieved and more complex tissue-like constructs can be made which will progress the development of stem cell therapies.
Presentations:
Bobak Mosadegh, Chuan-Hsien Kuo, Yi-Chung Tung, Yu-suke Torisawa, Shuichi Takayama. "A Monolithic Passive Check-valve for Systematic Control of Temporal Actuation in Microfluidic Devices". Proceedings of MicroTAS 2008, 826-828, 2008
Yu-suke Torisawa, Bobak Mosadegh, Gary D. Luker, Shuichi Takayama. "Hydrodynamic Cellular Patterning for 3D Co-culture". Proceedings of MicroTAS 2008, 27-29, 2008
Behzad Ebrahimi, Scott Swanson, Bobak Mosadegh, Timothy Chupp. "A Perfusion Phantom for Quantitative Medical Imaging". Proceedings of SPIE Vol. 6913, 6913-31, 2008
Publications:
Bobak Mosadegh, Wajeeh Saadi, Seog Woo Rhee, Frank Lin, Bong Geun Chung, Behrad Vahidi, Noo Li Jeon. "Generation of Stable Gradients in 2D and 3D Environments using a Microfluidic Diffusion Chamber". Biomedical Engineering Symposium, 2006.
Bobak Mosadegh, Carlos Huang, Jeong Won Park, Hwa-Sung Shin, Bong Geun Chung, Sun-Kyu Hwang, Kun-Hong Lee, Hyung Joon Kim, James Brody, Noo Li Jeon. "Generation of Stable Complex Gradients Across 2D Surfaces and 3D Gels". Langmuir, 23 (22), 10910-10912, 2007 PMID: 17910490
Faculty Mentor: Laurie McCauley
Home Department: Oral Health Sciences PhD Program, School of Dentistry
Research Project Title: Parathyroid hormone's anabolic action on bone marrow stromal cell proliferation
Research Project Description: Prior research in the McCauley lab demonstrated that ectopically implanted bone marrow stromal cells (BMSCs), under the influence of intermittent parathyroid hormone (PTH) administration, exhibit the greatest rate of increase in proliferation 7-14 days post initiation of PTH administration. In order to more closely identify the critical timeframe for PTH action, I examined daily time points versus previously studied weekly time points. Luciferase positive cells were harvested from luciferase mice, expanded in culture, seeded to Gelfoam sponges, and ectopically implanted into athymic nude mice. Daily PTH (1-34) administration was initiated one week post implantation, and luciferase imaging was carried out daily. The innovative ectopic BMSC implant model and luciferase imaging technology provide a unique model to analyze PTH's influence on in vivo BMSC proliferation. Determining the time it takes BMSCs, under the influence of PTH, to reach their peak rate of increase in proliferation will clinically facilitate better therapeutic strategies that optimize patients' response to PTH. The athymic nude mice were sacrificed at the last day of imaging in order to harvest the ectopic BMSC implants and serum. Histomorphometry was utilized to analyze implant bone per area, real time PCR was used to investigate implant PTH receptor and jagged1 gene expression, and serum TRAP 5b assay was carried out to examine osteoclast activity.
Oral Presentations:
Novince CM, Koh AJ, Brown HA, Hu JC, Rosol TJ, McCauley LK, Toribio RE. Parathyroid hormone related protein (PTHrP) nuclear localization sequence and C-terminus regulate craniofacial development. The American Society for Bone and Mineral Research Annual Meeting, 2008.
Poster Presentations:
Novince CM, Koh AJ, Marchesan JT, McCauley LK. Proteoglycan-4 regulates the anabolic actions of parathyroid hormone (1-34) in bone. University of Michigan School of Dentistry Research Day, 2009.
Publications:
Novince CM, Ward BB, McCauley LK. Osteonecrosis of the Jaw: An update and review of recommendations. Cells, Tissues, Organs. 2009; 189(1-4): 275-283. PMID: 18765930
Novince CM, McCauley LK. Toward a Better Understanding of Bisphosphonates and Their Potential for Impacting Orthodontic Therapy.
In: McNamara JA Jr, Kapila SD, eds. Temporomandibular Disorders and Orofacial Pain: Separating Controversy from Consensus. Monograph 46, Craniofacial Growth Series, Department of Orthodontics and Pediatric Dentistry and Center for Human Growth and Development, The University of Michigan, Ann Arbor, 2009;475-488.
Faculty Mentor Rotation: Dr. James Simmer
Home Department: Oral Health Sciences PhD Program, School of Dentistry
Research Project Title Rotation: FAM83H Isolation and Characterization
Research Project Description: (Summary of Rotation)
Fam83H is a non-secreted protein that is 1179 amino acids long that has been implicated in autosomal dominant amelogenesis imperfecta since mutations in the gene for the Fam83H protein lead to a hypocalcified type of AI which suggests that it is important for proper enamel formation. These patients don’t have any other known phenotypic changes, suggesting that this is an enamel-specific protein. It may interact with other proteins, but these interactions are presently unknown.
One of the aims of the project is to determine when, where, and in what subcellular compartment the protein is expressed. This will allow us to more easily isolate the protein so that we can further elucidate its function. We will use a vector to direct Fam83H expression in ameloblasts. This vector has been previously engineered by the laboratory to express ameloblastin and enamelin in ameloblast cells. This same vector, which contains a 5’ amelogenin promoter and a 3’ untranslated region, will be used to direct Fam83H expression in these cells. The 5’ promoter ends at a unique AscI restriction enzyme site. Previously, restriction analysis identified a single AscI site in the Fam83H mouse gene. We used site-directed mutagenesis to get rid of this restriction enzyme site so that the gene could be spliced into the vector in its entirety.
The mutation was induced using the QuikChange Site-Directed Mutagenesis Kit from Stratagene (#200518 and #200519). Two primers for PCR were ordered containing a point mutation to remove the AscI restriction enzyme site: 5’- ACAGGGCTCCGGCCACTCGCGCGCCCAACTGAGGC forward and 5’-GCCTCAGTTGGGCGCGCGAGTGGCCGGAGCCCTGT reverse. The point mutation did not change the amino acid sequence of the protein. The PCR product was then transformed into XL-1 Blue Supercompetent Cells which were grown on agar plates containing ampicillin. Two viable colonies were chosen and sent for sequencing. Sequencing confirmed that the mutation was induced correctly.
Future steps include inducing another point mutation to change a tryptophan (bp# here) into a stop codon. Two primers were ordered: 5’-GCAGCATTACCAGTGAGACCCACAGTTTGCTCCTGCGCGC forward and 5’-GCGCGCAGGAGCAAACTGTGGGTCTCACTGGTAATGCTGC. This amino acid was chosen since it is one of six nonsense mutations that were found in this gene. We are in the process of doing a large scale expression to try to isolate the Fam83H protein.
Publications:
Nunez S, Lee JS, Zhang Y, Bai G, Ro JY. Role of peripheral mu-opioid receptors in inflammatory orofacial muscle pain. Neuroscience. 2007 May 25;146(3):1346-54. Epub 2007 Mar 26. PMID: 17379421
Sahu SN, Nunez S, Bai G, Gupta A.INTERACTION OF PYK2 AND PTP-PEST WITH LEUPAXIN IN PROSTATE CANCER CELLS. Am J Physiol Cell Physiol. 2007 Feb 28; PMID: 17329398
Sahu SN, Khadeer MA, Robertson BW, Nunez SM, Bai G, Gupta A. Association of leupaxin with Src in osteoclasts. Am J Physiol Cell Physiol. 2007 Jan;292(1):C581-90. Epub 2006 Aug 16. PMID: 16914530
Summer 2009 Lab Rotation with Dr. Yvonne Kapila
Home Department: Oral Health Sciences PhD Program, School of Dentistry
Research Project Title: Nisin, an apoptogenic bacteriocin, modulates oral cancer cell growth.
Research Project Description: Lab rotation will involve work on a project investigating the effect of nisin, an apoptogenic bacteriocin, on oral squamous cell carcinoma in vitro and in vivo using a mouse model.
Academic Advisor: Yvonne Kapila
Home Department: Oral Health Sciences PhD Program, School of Dentistry
Research Project Description: I am investigating cell signaling mechanisms of oral cancer. I am currently completing my third research rotation and will choose a lab by fall 2009.
Presentations:
- Journal Clubs 2007, 2008
- Scanlon, C., Gerstner, G., Clauw, D., Graceley, R. "Neuroendocrine Response to Pain Suggests Differing Etiology of Temporomandibular Disorder and Other Chronic Pain Disorders."
University of Michigan Research Day. Ann Arbor, MI. February 2007.
University of Michigan Research Day. Ann Arbor, MI. February 2007.
NIDCR DDS/PhD Dual Degree Training Workshop. Bethesda, MD. September 2008.
Michigan Clinical Research Symposium. Ann Arbor, MI. September 2008. Scanlon, C.S., Mitra, R., D'Silva, N.J. "NFATc2 and Head and Neck Cancer Progression."
TEAM Retreat, Ann Arbor, MI. September 2008.
University of Michigan Research Day. Ann Arbor, MI. February 2009.
Faculty Mentor: Shuichi Takayama
Home Department: Macromolecular Science and Engineering
Research Project Title: Aqueous Two-Phase Systems for Endothelial Cell Patterning
Research Project Description: We are working on the development of a micropatterning approach to study the propagation of micro-environmental signals via cell signal transduction pathways, and the subsequent effect on cell growth, migration, and differentiation. Specifically, we will: 1) use cell printing techniques in conjunction with aqueous two phase systems to localize and study the dose dependence of growth factors on cell proliferation of differing cell types; 2) design a rapid and simple functional microarray to study the combinatory effects of growth factors on cell-environment interactions; 3) investigate the topology of tissue engineering scaffolds (Type I collagen and polylactic acid) on modulating cell spreading, growth, and migration. Since receptors for growth factors are sufficiently activated by their ligands only given adequate cell-matrix attachment, the latter research objective is critical. Preliminary studies will use basic fibroblast growth factor (FGF-2), which has been shown to increase the proliferation of endothelial cells.
Research Project Description:
Directions & Parking